300F

oligos: 
media: 

Sequence information

Direction: 
forward
Sequence: 
CAAGTACCGTGAGGGAAAGTTG
Target gene: 
Type: 
sequence primer

Lab status

In stock: 
yes
In stock since: 
Mon, 2019-02-18 08:30

Add new comment

You must have Javascript enabled to use this form.
Scratchpads developed and conceived by (alphabetical): Ed Baker, Katherine Bouton Alice Heaton Dimitris Koureas, Laurence Livermore, Dave Roberts, Simon Rycroft, Ben Scott, Vince Smith