4FB

oligos: 
media: 

Sequence information

Associated oligonucleotide(s): 
Direction: 
forward
Notes: 
Amplifies second half of the 18S gene. Typically used in the second step of a nested PCR reaction together with 1806R after first amplifying with TIMA/B.
Sequence: 
CCAGCAGCCGCGGTAATTCCAG
Target gene: 
Type: 
PCR primer
sequence primer

Lab status

In stock: 
yes
In stock since: 
Mon, 2019-02-18 16:51

Bibliographical references

Add new comment

You must have Javascript enabled to use this form.
Scratchpads developed and conceived by (alphabetical): Ed Baker, Katherine Bouton Alice Heaton Dimitris Koureas, Laurence Livermore, Dave Roberts, Simon Rycroft, Ben Scott, Vince Smith