5F

oligos: 
pcr: 
media: 
People: 

Sequence information

Associated oligonucleotide(s): 
Direction: 
forward
Sequence: 
GCGAAAGCATTTGCCAAGAA
Target gene: 
Type: 
sequence primer

Lab status

In stock: 
yes

Bibliographical references

Add new comment

You must have Javascript enabled to use this form.
Scratchpads developed and conceived by (alphabetical): Ed Baker, Katherine Bouton Alice Heaton Dimitris Koureas, Laurence Livermore, Dave Roberts, Simon Rycroft, Ben Scott, Vince Smith