5FK-acelA

oligos: 
pcr: 
media: 
People: 
Products and Equipment: 

Sequence information

Associated oligonucleotide(s): 
Direction: 
reversed
Sequence: 
AGAATTACGAGGGTATCTAATCCTCTTC
Target gene: 
Type: 
PCR primer
sequence primer

Lab status

In stock: 
yes
In stock since: 
Wed, 2011-11-09 23:00
Notes: 
Artspecifik.

Add new comment

You must have Javascript enabled to use this form.
Scratchpads developed and conceived by (alphabetical): Ed Baker, Katherine Bouton Alice Heaton Dimitris Koureas, Laurence Livermore, Dave Roberts, Simon Rycroft, Ben Scott, Vince Smith