7F

oligos: 
7FK
pcr: 
media: 

Sequence information

Associated oligonucleotide(s): 
Direction: 
forward
Sequence: 
GCAATAACAGGTCTGTGATGC
Target gene: 
Type: 
sequence primer

Lab status

In stock: 
yes

Bibliographical references

Add new comment

To prevent automated spam submissions leave this field empty.
CAPTCHA
This question is for testing whether or not you are a human visitor and to prevent automated spam submissions.
Image CAPTCHA
Enter the characters shown in the image.
Scratchpads developed and conceived by (alphabetical): Ed Baker, Katherine Bouton Alice Heaton Dimitris Koureas, Laurence Livermore, Dave Roberts, Simon Rycroft, Ben Scott, Vince Smith